Abstract
Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM) like elevated serum creatine kinase (CK) levels, distal muscle weakness, myopathic changes in electromyography (EMG) and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT) in the DYSF gene (NM_001130987.1_c.897-918dup, p.Gly307Leufs5X), which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup, p.Gly307Leufs5X) in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.
| Original language | English (US) |
|---|---|
| Pages (from-to) | 1190-1195 |
| Number of pages | 6 |
| Journal | Saudi Medical Journal |
| Volume | 38 |
| Issue number | 12 |
| DOIs | |
| Publication status | Published - Dec 2017 |
| Externally published | Yes |
Keywords
- Consanguinity
- DYSF
- Miyoshi myopathy
- Novel frameshift mutation
- Pakistan
Fingerprint
Dive into the research topics of 'Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy'. Together they form a unique fingerprint.Cite this
- APA
- Author
- BIBTEX
- Harvard
- Standard
- RIS
- Vancouver